ID: 1123775556_1123775557

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1123775556 1123775557
Species Human (GRCh38) Human (GRCh38)
Location 15:23575630-23575652 15:23575660-23575682
Sequence CCATTCTTGCAGAGATGAGTGAG TCTTGAGTTCTCTAGAGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 300} {0: 1, 1: 0, 2: 2, 3: 18, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!