ID: 1123783113_1123783120

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1123783113 1123783120
Species Human (GRCh38) Human (GRCh38)
Location 15:23646008-23646030 15:23646036-23646058
Sequence CCTGCGGGGCAGACAGTGGGGCA CGGGGCCGGCAGCACAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 270} {0: 1, 1: 1, 2: 3, 3: 24, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!