ID: 1123829358_1123829363

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1123829358 1123829363
Species Human (GRCh38) Human (GRCh38)
Location 15:24118245-24118267 15:24118258-24118280
Sequence CCACTCCATTCCCACCAAGGTTG ACCAAGGTTGCCACAGTCTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!