ID: 1123881525_1123881530

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1123881525 1123881530
Species Human (GRCh38) Human (GRCh38)
Location 15:24680655-24680677 15:24680680-24680702
Sequence CCAGTCAGAACCGCACTGTATTT GTGGTCTTCTGCACTGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 139} {0: 1, 1: 0, 2: 2, 3: 23, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!