ID: 1123958006_1123958009

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1123958006 1123958009
Species Human (GRCh38) Human (GRCh38)
Location 15:25360454-25360476 15:25360481-25360503
Sequence CCTTGTTCTCCTTCAAATTCCAC AACTGCTTCTTCAAGTCTGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 28, 4: 372} {0: 1, 1: 1, 2: 1, 3: 17, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!