ID: 1124010240_1124010243

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1124010240 1124010243
Species Human (GRCh38) Human (GRCh38)
Location 15:25832294-25832316 15:25832324-25832346
Sequence CCTGGTGTATGGTAATCTGTTAT TCAGGAAACTCATTCAGCAATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 15, 3: 340, 4: 2162} {0: 1, 1: 0, 2: 2, 3: 26, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!