ID: 1124090518_1124090526

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1124090518 1124090526
Species Human (GRCh38) Human (GRCh38)
Location 15:26595644-26595666 15:26595696-26595718
Sequence CCAAGTGGAGCCTAAAGCAACCC TTCTGATTAACCCCTGTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 5, 1: 30, 2: 87, 3: 91, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!