ID: 1124096291_1124096293

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1124096291 1124096293
Species Human (GRCh38) Human (GRCh38)
Location 15:26651400-26651422 15:26651416-26651438
Sequence CCTTCTGCATTCAGCTACTTGCT ACTTGCTGATAAAAACCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195} {0: 1, 1: 0, 2: 0, 3: 21, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!