ID: 1124101855_1124101863

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1124101855 1124101863
Species Human (GRCh38) Human (GRCh38)
Location 15:26703207-26703229 15:26703241-26703263
Sequence CCTCACAGTTCTAGAGGCTGGAA CAGGCACCGGCACCTGGTGGGGG
Strand - +
Off-target summary {0: 11, 1: 123, 2: 329, 3: 609, 4: 1039} {0: 1, 1: 0, 2: 1, 3: 28, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!