ID: 1124111191_1124111195

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1124111191 1124111195
Species Human (GRCh38) Human (GRCh38)
Location 15:26790229-26790251 15:26790259-26790281
Sequence CCAAATAACAAACATTCCACAGA ACATTGCCACAGATGCTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 282} {0: 1, 1: 0, 2: 0, 3: 11, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!