ID: 1124126111_1124126117

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1124126111 1124126117
Species Human (GRCh38) Human (GRCh38)
Location 15:26939295-26939317 15:26939309-26939331
Sequence CCCACACAGCCAGGCAAATCCAG CAAATCCAGAGAAGGCACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 265} {0: 1, 1: 0, 2: 5, 3: 25, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!