ID: 1124147683_1124147689

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1124147683 1124147689
Species Human (GRCh38) Human (GRCh38)
Location 15:27143328-27143350 15:27143360-27143382
Sequence CCTTAGCCTCTCTAAGCACTGGG GTGAGCTACCATATCTGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 14, 2: 246, 3: 3277, 4: 25497} {0: 1, 1: 0, 2: 23, 3: 291, 4: 1664}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!