ID: 1124160343_1124160346

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1124160343 1124160346
Species Human (GRCh38) Human (GRCh38)
Location 15:27262525-27262547 15:27262571-27262593
Sequence CCATCTGAGTATTGAGGAAGCTC CATTCTTACTCATTTGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 553} {0: 1, 1: 0, 2: 15, 3: 12, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!