ID: 1124210793_1124210805

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1124210793 1124210805
Species Human (GRCh38) Human (GRCh38)
Location 15:27763704-27763726 15:27763757-27763779
Sequence CCTGGGAAGCAGGGCTGCTGGGC GAGGTTGCCCTGGTACTGGGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 66, 4: 534} {0: 1, 1: 0, 2: 1, 3: 19, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!