ID: 1124232743_1124232744

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1124232743 1124232744
Species Human (GRCh38) Human (GRCh38)
Location 15:27959634-27959656 15:27959653-27959675
Sequence CCTGGGTGCGGGCTGGAAGTCTC TCTCTCCATGCCTTTATGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143} {0: 1, 1: 1, 2: 2, 3: 22, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!