ID: 1124266455_1124266459

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1124266455 1124266459
Species Human (GRCh38) Human (GRCh38)
Location 15:28239480-28239502 15:28239498-28239520
Sequence CCTGTACAAATTGTACCTCCTGC CCTGCTAACCAGACAGCAGAGGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 11, 4: 111} {0: 8, 1: 0, 2: 1, 3: 21, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!