ID: 1124272976_1124272989

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1124272976 1124272989
Species Human (GRCh38) Human (GRCh38)
Location 15:28300135-28300157 15:28300170-28300192
Sequence CCAAAAGCAAGTACCAATGACTA TGGGGAGGGGACATGGACAAAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 2, 3: 15, 4: 142} {0: 4, 1: 0, 2: 8, 3: 55, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!