ID: 1124282737_1124282744

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1124282737 1124282744
Species Human (GRCh38) Human (GRCh38)
Location 15:28378443-28378465 15:28378466-28378488
Sequence CCCTCTCCCAGAGTTGGCGGCCT CTCCCCTCTCTTAGAGTGGGTGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 6, 3: 16, 4: 158} {0: 12, 1: 5, 2: 6, 3: 36, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!