ID: 1124282846_1124282854

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1124282846 1124282854
Species Human (GRCh38) Human (GRCh38)
Location 15:28378965-28378987 15:28378994-28379016
Sequence CCCCACCCCTTCAGCAAGCAGCC CTGCCCTCACCAATCACCCCAGG
Strand - +
Off-target summary {0: 21, 1: 10, 2: 5, 3: 31, 4: 333} {0: 7, 1: 4, 2: 42, 3: 30, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!