ID: 1124364574_1124364582

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1124364574 1124364582
Species Human (GRCh38) Human (GRCh38)
Location 15:29062884-29062906 15:29062916-29062938
Sequence CCCATCTCGTGGGGCTGTGGGGA ATCTGGGTCAGTGTCTGTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 263} {0: 4, 1: 1, 2: 1, 3: 18, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!