ID: 1124376824_1124376826

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1124376824 1124376826
Species Human (GRCh38) Human (GRCh38)
Location 15:29133762-29133784 15:29133798-29133820
Sequence CCAGTGACAGCGGCAGCTAACTC CTACAGCTCCTGTCATCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66} {0: 1, 1: 0, 2: 1, 3: 13, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!