ID: 1124381265_1124381275

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1124381265 1124381275
Species Human (GRCh38) Human (GRCh38)
Location 15:29168776-29168798 15:29168816-29168838
Sequence CCCCACATGGTGCCTGCTGTTTG CTCTGGGCAAGGACCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 237} {0: 1, 1: 0, 2: 3, 3: 38, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!