ID: 1124385901_1124385904

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1124385901 1124385904
Species Human (GRCh38) Human (GRCh38)
Location 15:29207944-29207966 15:29207961-29207983
Sequence CCATCAGTGGGGGTCACCCCACC CCCACCTTCCCTGCCAAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152} {0: 1, 1: 0, 2: 2, 3: 32, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!