ID: 1124387574_1124387580

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1124387574 1124387580
Species Human (GRCh38) Human (GRCh38)
Location 15:29223296-29223318 15:29223317-29223339
Sequence CCAGACAAGTCCTCCTGGTTCTG TGGGCTGGAGAGAGTTTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193} {0: 1, 1: 0, 2: 0, 3: 18, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!