ID: 1124488226_1124488231

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1124488226 1124488231
Species Human (GRCh38) Human (GRCh38)
Location 15:30137925-30137947 15:30137939-30137961
Sequence CCTGAAAGATCTGGAGGTAAGAG AGGTAAGAGGCTCTGGGCGGAGG
Strand - +
Off-target summary {0: 10, 1: 12, 2: 26, 3: 20, 4: 206} {0: 6, 1: 13, 2: 17, 3: 27, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!