ID: 1124497006_1124497012

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1124497006 1124497012
Species Human (GRCh38) Human (GRCh38)
Location 15:30192863-30192885 15:30192882-30192904
Sequence CCTCAGTCTGTCCCAGAGGGTGA GTGAGGTCAAGGCTGGTGCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!