ID: 1124521816_1124521827

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1124521816 1124521827
Species Human (GRCh38) Human (GRCh38)
Location 15:30411360-30411382 15:30411404-30411426
Sequence CCTCCACCCAGAGCCTCTTACCT ATGATGTAGGGCCTTCCCTGTGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 15, 3: 47, 4: 389} {0: 8, 1: 0, 2: 4, 3: 14, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!