ID: 1124522203_1124522209

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1124522203 1124522209
Species Human (GRCh38) Human (GRCh38)
Location 15:30413908-30413930 15:30413932-30413954
Sequence CCTGGGGTGATTGGCGAGGGCAA GACTGGGCTGCTTGCTGAAGGGG
Strand - +
Off-target summary {0: 10, 1: 0, 2: 20, 3: 21, 4: 104} {0: 22, 1: 8, 2: 6, 3: 20, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!