ID: 1124542927_1124542935

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1124542927 1124542935
Species Human (GRCh38) Human (GRCh38)
Location 15:30604331-30604353 15:30604359-30604381
Sequence CCCACCCCTTCAGCAAGCAGCCC TTGCCCTCGCCAATCACCCCAGG
Strand - +
Off-target summary {0: 21, 1: 10, 2: 6, 3: 38, 4: 321} {0: 10, 1: 0, 2: 20, 3: 21, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!