|
Left Crispr |
Right Crispr |
| Crispr ID |
1124543437 |
1124543439 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:30607426-30607448
|
15:30607440-30607462
|
| Sequence |
CCTCTTGGGGAAGTGCTAGCCTG |
GCTAGCCTGACTGGTTGTCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 5, 2: 0, 3: 17, 4: 142} |
{0: 20, 1: 16, 2: 1, 3: 6, 4: 89} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|