|
Left Crispr |
Right Crispr |
Crispr ID |
1124642788 |
1124642792 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:31407001-31407023
|
15:31407018-31407040
|
Sequence |
CCTTTTTCCATGTGAGATAACAT |
TAACATATTCGTAGGTTCCAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 4, 2: 65, 3: 369, 4: 1369} |
{0: 3, 1: 15, 2: 135, 3: 390, 4: 780} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|