ID: 1124656921_1124656935

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1124656921 1124656935
Species Human (GRCh38) Human (GRCh38)
Location 15:31516362-31516384 15:31516408-31516430
Sequence CCATGTGAGCAACTGAAACCTGC GAGGATCCCAGCTCCAGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131} {0: 1, 1: 0, 2: 1, 3: 30, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!