ID: 1124665128_1124665132

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1124665128 1124665132
Species Human (GRCh38) Human (GRCh38)
Location 15:31585848-31585870 15:31585865-31585887
Sequence CCGGGAGTTGTAATGACATCAAT ATCAATAGAGAGAGGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 102} {0: 1, 1: 0, 2: 7, 3: 240, 4: 2014}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!