ID: 1124677251_1124677266

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1124677251 1124677266
Species Human (GRCh38) Human (GRCh38)
Location 15:31696753-31696775 15:31696806-31696828
Sequence CCCAGATGGGGGTGGGTGCCCAC CTTTCAGGGCAAATGCAGCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 26, 4: 186} {0: 1, 1: 1, 2: 0, 3: 17, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!