ID: 1124693140_1124693155

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1124693140 1124693155
Species Human (GRCh38) Human (GRCh38)
Location 15:31842511-31842533 15:31842562-31842584
Sequence CCCTCTGATGGCTGGTTTCAATG GGGGCTGGTGGGGGACAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 105, 4: 167} {0: 1, 1: 0, 2: 12, 3: 183, 4: 1186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!