ID: 1124696669_1124696677

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1124696669 1124696677
Species Human (GRCh38) Human (GRCh38)
Location 15:31870034-31870056 15:31870056-31870078
Sequence CCGGCGAGCGGCCTCGCGCGCGG GCTCGGGGCCGGGCCCTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81} {0: 1, 1: 0, 2: 7, 3: 47, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!