ID: 1124712889_1124712902

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1124712889 1124712902
Species Human (GRCh38) Human (GRCh38)
Location 15:32030252-32030274 15:32030302-32030324
Sequence CCAGAGGCGCGAGGCCGAGAGCC GCCCGGAGCGTACCCAGCGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!