ID: 1124755683_1124755687

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1124755683 1124755687
Species Human (GRCh38) Human (GRCh38)
Location 15:32402939-32402961 15:32402961-32402983
Sequence CCTGGGGTGATTGGCGAGGGCAA AGGACTGGGCTGCTTGCTGAAGG
Strand - +
Off-target summary {0: 10, 1: 0, 2: 20, 3: 21, 4: 104} {0: 6, 1: 15, 2: 9, 3: 41, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!