|
Left Crispr |
Right Crispr |
| Crispr ID |
1124818212 |
1124818221 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:33018100-33018122
|
15:33018124-33018146
|
| Sequence |
CCTACCCCCTTAAGGTGATGGTA |
TAGGAGATGGAGCCTTTGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 4, 3: 25, 4: 123} |
{0: 11, 1: 88, 2: 595, 3: 1506, 4: 2488} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|