ID: 1124870978_1124870980

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1124870978 1124870980
Species Human (GRCh38) Human (GRCh38)
Location 15:33542265-33542287 15:33542285-33542307
Sequence CCAGCACTTGGCAGTGTTCTCTG CTGTGTGAGTAGGATATTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 202} {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!