ID: 1124947199_1124947202

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1124947199 1124947202
Species Human (GRCh38) Human (GRCh38)
Location 15:34279996-34280018 15:34280016-34280038
Sequence CCATGCACCTGGGAGAATGGAGA AGACAGAGTGAAATGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 297} {0: 1, 1: 0, 2: 7, 3: 38, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!