|
Left Crispr |
Right Crispr |
Crispr ID |
1124977157 |
1124977164 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:34536187-34536209
|
15:34536204-34536226
|
Sequence |
CCACCCACTCTGAGAGAGGGGAG |
GGGGAGGGGCCGCCCGCTCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 17, 2: 23, 3: 150, 4: 330} |
{0: 2, 1: 7, 2: 5, 3: 40, 4: 254} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|