ID: 1124979020_1124979025

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1124979020 1124979025
Species Human (GRCh38) Human (GRCh38)
Location 15:34554992-34555014 15:34555031-34555053
Sequence CCTTCCTAGAGGAGACCAGCTTG ATGCCCAGAGCAGCAGCCCACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 116} {0: 2, 1: 0, 2: 7, 3: 53, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!