ID: 1125062187_1125062191

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1125062187 1125062191
Species Human (GRCh38) Human (GRCh38)
Location 15:35437741-35437763 15:35437778-35437800
Sequence CCAGCAAACCAGTCAGTGGCAAA TCTATCTTGTTTTATGTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 28, 4: 192} {0: 3, 1: 40, 2: 63, 3: 166, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!