ID: 1125156431_1125156438

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1125156431 1125156438
Species Human (GRCh38) Human (GRCh38)
Location 15:36591989-36592011 15:36592012-36592034
Sequence CCACTTTATGCCAGCCATCCAGT GCCATGCAGGAATGTGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 142} {0: 1, 1: 1, 2: 5, 3: 28, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!