ID: 1125189840_1125189844

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1125189840 1125189844
Species Human (GRCh38) Human (GRCh38)
Location 15:36977988-36978010 15:36978041-36978063
Sequence CCCTCTAGAAAGGCACATGTTCT TTTGATAAGCAGTTATTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 169} {0: 1, 1: 0, 2: 3, 3: 24, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!