ID: 1125191934_1125191936

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1125191934 1125191936
Species Human (GRCh38) Human (GRCh38)
Location 15:37003700-37003722 15:37003730-37003752
Sequence CCAAATTCATATTTGGGGGTTGA ACCCCCAATGTGAGGATATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 138} {0: 1, 1: 29, 2: 237, 3: 1094, 4: 2432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!