ID: 1125193416_1125193425

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1125193416 1125193425
Species Human (GRCh38) Human (GRCh38)
Location 15:37019650-37019672 15:37019703-37019725
Sequence CCCGTAGAGGGTAGGGAGAGCAT GAAACGCAGGGCCCAACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 138} {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!