ID: 1125270113_1125270121

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1125270113 1125270121
Species Human (GRCh38) Human (GRCh38)
Location 15:37929506-37929528 15:37929551-37929573
Sequence CCCACCTGCAGGGCCAACTTCAT CACAGGGAACTACATTCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 159} {0: 1, 1: 0, 2: 4, 3: 15, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!