ID: 1125431020_1125431026

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1125431020 1125431026
Species Human (GRCh38) Human (GRCh38)
Location 15:39593554-39593576 15:39593591-39593613
Sequence CCCCACGAGGGCTCAGGGATACT AAAGTTGTAAACTCCACCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73} {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!